(h) Lane M: 100bp ladder, Lane 1 Amplified

(h) Lane M: 100bp ladder, Lane 1 Amplified product of K.

pneumonia strain            of Hindon River(i) Lane M: 100bp ladder, Lane 1 Amplified product of E. coli strain                              of Faridabad waste water(j) Lane M: 100bp ladder, Lane 1 Amplified product of K. pneumonia strain                              of Faridabad waste water(k) Lane M: 100bp ladder, Lane 1 Amplified product of E.

We Will Write a Custom Essay Specifically
For You For Only $13.90/page!


order now

coli strain            of Canal water(l) Lane M: 100bp ladder, Lane 1 Amplified product of K. pneumonia strain           of Canal water.                 Molecular mechanisms underlying Plasmid-mediated quinolone Resistance genes         4.6.2 Distribution of genes encoding PMQR    Following PCR-based detection, the qnrS, aaclb-cr genes were  identified in E.coli (14/46) 30.

43 % & K. pneumonia (12/30) 40% and aac-lb-cr in the E. coli (9/46) 19.56 % & K. pneumonia (7/30) 23.

33 % strains in that order (Fig.23 & 24)           M    1 456 bp 1 M    M   1 1111                                         M     1 M   1 M    1 M   1     456bp 456bp    456bp   456bp                                                                                          a                           b                          c                                            d                          M     1    M    1  M     1                  M    1 456bp 456bp 456bp 456bp                                                                                     e                         f                        g                      h M     1 M     1   M      1 M     1   456bp   456bp  456bp 456bp                                                                                                           i                         j                        k                      lFig. 49: Amplification products observed in 1% agarose gels. (A) Representative              amplicons for qnrS from E. coli strains  (B) Representative amplicons for              qnrS from K. pneumonia strains.              (a) Lane M: 100bp ladder.  Lane 1: Amplified product of E.

coli strain             (b) Lane M: 100bp ladder.  Lane-1: Amplified product of K. pneumonia strain   (c) Lane M: 100bp ladder, Lane  1 Amplified product of E. coli strain          of Sewage water   (d) Lane M: 100bp ladder, Lane  1 Amplified product of K.

pneumonia strain         of Sewage water   (e) Lane M: 100bp ladder, Lane 1 Amplified product of E. coli strain of           Ground water   (f)  Lane M: 100bp ladder, Lane 1 Amplified product of K. pneumonia strain               of Ground water   (g) Lane M: 100bp ladder, Lane 1 Amplified product of E. coli strain               of Hindon River   (h) Lane M: 100bp ladder, Lane 1 Amplified product of K.

pneumonia strain              of Hindon River   (i) Lane M: 100bp ladder, Lane 1 Amplified product of E. coli strain              of Faridabad waste water   (j) Lane M: 100bp ladder, Lane 1 Amplified product of K. pneumonia strain              of Faridabad waste water   (k) Lane M: 100bp ladder, Lane 1 Amplified product of E. coli strain               of Canal water   (l) Lane M: 100bp ladder, Lane 1 Amplified product of K. pneumonia strain              of Canal water         482bp M      1       2 M    1      2 482bp                                                                     a                                                                               b      482bp   M     1     M   1   2           482bp 482bp 456bp M 1 2 1 M                                                                          c                                                                            d                                   482bp M      1 M    1 482bp                                                                                                            e                                                               f  M      1    M     1 482bp     482bp                                                     g                                                          h                        M       1 482bp 482bp M      1                                                         i                                                          j  M      1 482bp M     1 482bp                                                        k                                                          l                      Fig. 50 : Amplification products observed in 1% agarose gels.

(A) Representative                                  amplicons for   aac lb-cr from E.coli strains (B) Representative amplicons                                   for aac lb-cr from K. pneumonia strains(a) Lane M: 100bp ladder.  Lane 1-2: Amplified product of E. coli  strain(b) Lane M: 100bp ladder. Lane-1 to 2: Amplified product of K.

pneumonia       strain         (c) Lane M: 100bp ladder, Lane  1to 2 Amplified product of E. coli strain               of Sewage water         (d) Lane M: 100bp ladder, Lane  1 Amplified product of K. pneumonia strain               of Sewage water        (e)  Lane M: 100bp ladder, Lane 1 Amplified product of E. coli strain of                  Ground water        (f)  Lane M: 100bp ladder, Lane 1 Amplified product of K.

pneumonia strain                    of Ground water       (g)  Lane M: 100bp ladder, Lane 1 Amplified product of E. coli strain                    of Hindon River       (h)  Lane M: 100bp ladder, Lane 1 Amplified product of K. pneumonia strain                    of Hindon River       (i)   Lane M: 100bp ladder, Lane 1 Amplified product of E. coli strain                    of Faridabad waste water       (j)   Lane M: 100bp ladder, Lane 1 Amplified product of K. pneumonia strain                    of Faridabad waste water      (k)   Lane M: 100bp ladder, Lane 1 Amplified product of E.

coli strain                    of Canal water      (l)    Lane M: 100bp ladder, Lane 1 Amplified product of K. pneumonia strain                    of Canal water            An overview to distribution of virulence gene which cause antibiotic resistance Table 56 &             57.   Genes Frequency Percentage TEM 46 65.21% CTX-M 46 34.

7 % QnrS 46 30.43 % Aac lb-cr 46 19 %              Table 56:  Frequency and distribution of virulence gene in collected strains in E. coli Genes Frequency Percentage TEM 30 66.66 % CTX-M 30 36.66 % QnrS 30 19.

56% Aac lb-cr 30 23.33 %               Table 57:  Frequency and distribution of virulence gene in collected strains in K.                               Pneumonia.     Genes Respective Genes of ESBL presence in E.

coli Respective genes of ESBL is not presence in E. coli TEM 65.21% 34.79 % CTX-M 34.

7 % 65.3 % QnrS 30.43 % 69.57 % Aac lb-cr 19 % 81 %                                    Table  58 : Showing scoring of ESBL & PMQR genes in E. coli strains   Genes Respective Genes of ESBL & PMQR  presence in K.

pneumonia Respective genes of ESBL & PMQR is not presence in K. pneumonia TEM 66.66 % 33.44 % CTX-M 36.

66 % 63.33 % QnrS 19.56 % 80.44 % Aac lb-cr 23.33 % 76.67 %                                       Table  59 : Showing scoring of ESBL & PMQR genes in K.

pneumonia strains            4.7 DNA sequencing            We have done DNA sequencing from 16Sr RNA, TEM, CTX-M and qnrS gene, we also              considered the selected gene, like 16Sr RNA, ESBL & PMQR.4.7.1 Sequences for 16Sr RNA gene: >16S-PUJA SAMPLE-1                        521AGACATCCCATCGCACGGTATTCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTGCGGGTAACGTCAATGAGCAAAGGTATTAACTTTACTCCCTTCCTCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGATCGTCGCCTAGGTGAGCCGTTACCCCACCTACGAGCTAAACCCATCTGGGCACATCCGATGGCAAGAA>16S-PUJA SAMPLE-2                   365GGGGGGGCTTTGGCACGGTATTCCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCAATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTGCGGGTAACGTCTTGACCAAAGGTATTAACTTTACTCCCTTCCTCCCCGCTGAAAGTACTTTACAACCAGAAGGCCTTCTTCATACACACGACATGGATGCATCAAGCTTGCGGCCCATTG>16S-PUJA SAMPLE-3                         685 AGGGGGCCTTGGCACGGTATTCTCCAGATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTGCGGGTAACGTCAATGAGCAAAGGTATTAACTTTACTCCCTTCCTCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGATCGTCGCCTAGGTGAGCCGTTACCCCACCTACTAGCTAATCCCATCTGGGCACATCCGATGGCAAGAGGCCCGAAGGTCCCCCTCTTTGGTCTTGCGACGTTATGCGGTATTAGCTACCGTTTCCAGTAGTTATCCCCCTCCATCAGGCAGTTTCCCAGACATTACTCACCCGTCCGCCACTCGTCAGCAAAGAAGCAAGCTTCTTCCTGTTACCGTTCGACTTGCATGTAAA            >16S-PUJA SAMPLE-4                  689AGCCTTGTCATCATATCGTACTATTCTACTTATCTCTACGCATTTCACCGCTACACCTGGAATTCTACCCCCCTCTACGAGACTCAAGCTTGCCAGTATCAGATGCAGTTCCCAGGTTGAGCCCGGGGATTTCACATCTGACTTAACAAACCGCCTGCGTGCGCTTTACGCCCAGTAATTCCGATTAACGCTTGCACCCTCCGTATTACCGCGGCTGCTGGCACGGAGTTAGCCGGTGCTTCTTCTGCGGGTAACGTCAATGAGTAAAGGTATTAACTTTACTCCCTTCCTCCCCGCTGAAAGTACTTTACAACCCGAAGGCCTTCTTCATACACGCGGCATGGCTGCATCAGGCTTGCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGTGGCTGGTCATCCTCTCAGACCAGCTAGGGATCGTCGCCTAGGTGAGCCGTTACCCCACCTACTAGCTAATCCCATCTGGGCACATCCGATGGCAAGAGGCCCGAAGGTCCCCCTCTTTGGTCTTGCGACGTTATGCGGTATTAGCTACCGTTTCCAGTAGTTATCCCCCTCCATCAGGCAGTTTCCCAGACATTACTCACCCGTCCGCCACTCGTCAGCGAAACAGCAAGCTGCTTCCTGTTACCGTTCGCTTTTGGCATGTA

x

Hi!
I'm Mary!

Would you like to get a custom essay? How about receiving a customized one?

Check it out